Ensembl
LightNews LightNews
banner
ensembl.org
Ensembl
@ensembl.org
1.2K followers 79 following 94 posts
The Ensembl project seeks to enable genomic science by providing high-quality, integrated annotation.

Vertebrates: www.ensembl.org
Non-vertebrates: www.ensemblgenomes.org

You can test the new Ensembl browser and share your feedback at beta.ensembl.org
Posts Replies Media Videos
Pinned
ensembl.org
Ensembl @ensembl.org · Sep 2
📢 Happy to announce that Ensembl 115 and Ensembl Genomes 62 are out! This release features ~120000 new protein coding transcripts in human GRCh38, 2 new cattle, 7 new plants and 20 new metazoa! 🧬🐮 🫛🪲
Read more here ➡️ zurl.co/poyXM
Ensembl 115 has been released! – Ensembl Blog
zurl.co
ensembl.org
Uniprot @uniprot is developing new strategies and workflows for reference proteomes of agricultural species - Pedro Raposo presents at #PAG33
January 11, 2026 at 6:57 PM
ensembl.org
Elspeth Bruford presents on gene naming by the HUGO gene nomenclature committee, over 44000 genes named to date! “Nomenclature should not be offensive or pejorative”! @hgnc.bsky.social #PAG33
January 11, 2026 at 6:38 PM
ensembl.org
New long transcriptomic data are introducing complexities and opportunities into manual genome annotation! Jane Loveland @janeloveland.bsky.social shares new insights @gencodegenes.bsky.social #PAG33
January 11, 2026 at 6:07 PM
ensembl.org
José Pérez-Silva @jgperezsilva.bsky.social presents on gene annotation methods used by Ensembl at #PAG33
January 11, 2026 at 5:37 PM
ensembl.org
If you're in sunny San Diego for #PAG33, join us at our workshop, “Integrated Genome Resources at EMBL-EBI”, to learn more about our exciting new features and data resources for genomics and pangenomics!

It's on Sunday 11 January from 8:00– 12:00, we hope to see you there!
January 9, 2026 at 11:31 PM
ensembl.org
New #GeneAnnotation has been added to #Ensembl Beta, including annotation for Dasypus novemcinctus and Buteo buteo!
You can explore all available species here: beta.ensembl.org/species-sel...

Image credits:
commons.wikimedia.org/wiki/F...
commons.wikimedia.org/wiki/F...
Photographs of the nine-banded armadillo and common buzzard.
January 8, 2026 at 4:15 PM
ensembl.org
Hello, happy New Year!

Three roles are currently open at Ensembl:

Genomic Data Analyst
Closing date: 10 Jan 2026

Genomic Data Analyst Project Lead
Closing date: 10 Jan 2026

Senior Platform Developer
Closing date: 24 Jan 2026

More info on current vacancies here (www.ensembl.info/category/06-...)
Jobs @ Ensembl – Ensembl Blog
www.ensembl.info
January 5, 2026 at 1:30 PM
Reposted by Ensembl
gencodegenes.bsky.social
The HAVANA team at EMBL-EBI has multiple open positions to support the GENCODE and PARADIGM projects. We're recruiting gene annotators (bit.ly/4qG28g5), an annotation project lead (bit.ly/4qv05v6), and bioinformaticians (bit.ly/4qevYIY). Please apply via the links. We’d love to hear from you!
Genomic Data Analyst
About the Team The HAVANA team, part of Ensembl, produces reference-quality gene annotation for the human and mouse genomes as a core contributor to the GENCODE project, a Global Core Biodata Resource...
embl.wd103.myworkdayjobs.com
January 5, 2026 at 12:55 PM
ensembl.org
Riddle number two of the day: this photo was taken at the very last stop of our final Ensembl workshop of the year… can you guess where?
December 25, 2025 at 10:29 AM
ensembl.org
From all of us at Ensembl, we wish you holidays filled with "ATGGAACGCCGCATTATGGAAAACACCGCGAACGATCCGGAAGCGTGCGAA"
May your celebrations be as perfectly in‑frame as your favourite gene.
December 25, 2025 at 9:10 AM
ensembl.org
Ensembl Job alert! Bioinformatics Developer in Ensembl Compara
Apply here: www.ensembl.info/2025/12/10/...
Closing date: 12 January 2026
Job: Bioinformatics Developer Ensembl Compara – Ensembl Blog
www.ensembl.info
December 10, 2025 at 10:06 AM
Reposted by Ensembl
opentargets.org
#OnThisDay 10 years ago, we launched the Open Targets Platform! 🎂 🧬🖥️
Graphic with a 10 surrounded by fireworks and the Open Targets Platform logo
December 8, 2025 at 10:21 AM
ensembl.org
In Nov, @aleenamolbio.bsky.social from Ensembl Outreach visited Uni Valle Colombia to introduce 100 students from 3 public schools in Valle del Cauca to EMBL-EBI research & open-access bioinformatics training. Inspiring the next generation of scientists! 🌱🔬 #STEM #Bioinformatics #Outreach
December 5, 2025 at 4:49 PM
ensembl.org
Attention developers and researchers working with Ensembl programmatically! Upcoming Ensembl API and data access changes are live on our blog. Read more about the new platform, new services, and migration timelines here: www.ensembl.info/2025/12/02/...
December 2, 2025 at 5:03 PM
ensembl.org
Our Ensembl 2026 paper is out!
Learn about 1,900+ new genomes, expanded pangenome support, new regulation interfaces, and what’s coming in our 2026 releases.
doi.org/10.1093/nar/gkaf1239
Ensembl 2026
Abstract. The Ensembl project (https://www.ensembl.org) is a public and open resource providing access to genomes, annotations, high-quality tools, and met
academic.oup.com
November 28, 2025 at 4:30 PM
ensembl.org
New datasets available on beta.ensembl.org! Highlights include oats from the PanOat project, human assemblies from HPRC Release 2 and the pocket water lily, submitted by
Fujian Agriculture and Forestry University
Image credit - commons.wikimedia.org/wiki/F...
November 18, 2025 at 2:59 PM
Reposted by Ensembl
geneticssociety.bsky.social
New Webinar: This Wednesday, join speakers Jorge Barista da Rocha, PhD, and Jane Loveland, PhD, as they explore the @ensembl.org genome browser and provide practical skills beyond the traditional reference genome. Register here: bit.ly/432kP4b #ASHG #HumanGenetics @gencodegenes.bsky.social
November 17, 2025 at 5:02 PM
Reposted by Ensembl
ebi.embl.org
Antimicrobial resistance (AMR) is a growing health threat, making infections harder to treat and complicating routine medical care.

EMBL-EBI’s new AMR portal brings together laboratory resistance data and bacterial genomes in one open platform.

#WAAW2025 #ActOnAMR

www.ebi.ac.uk/about/news/t...
🧬💻
A new gateway to global antimicrobial resistance data
New online portal connects bacterial genomes with experimental resistance data to support antimicrobial resistance research.
www.ebi.ac.uk
November 18, 2025 at 9:59 AM
ensembl.org
Ensembl job alert! We are looking for a bioinformatics developer to join our Genebuild team: zurl.co/QpnKj
Closing date: 11 Dec 2025
Job: Bioinformatics Developer – Ensembl Genebuild – Ensembl Blog
zurl.co
November 14, 2025 at 2:36 PM
ensembl.org
Join us tomorrow to explore Ensembl resources for pangenomes! Leanne Haggerty is presenting on Ensembl annotation for human, model organism, livestock & crop plant pangenomes.

Free registration: zurl.co/3sSUJ 

Full series:zurl.co/XrVdc
#Pangenomes #Ensembl
November 11, 2025 at 3:20 PM
Reposted by Ensembl
gwascatalog.bsky.social
🚨 NEWS! The GWAS Catalog Diagram is back up! 🚨
Smoother, faster loading for filtered views!
🗺️ Explore now 👉 www.ebi.ac.uk/gwas/diagram
Tell us what you think! Are there any features you would like? Help us to make it useful for the #gwas community
November 5, 2025 at 3:59 PM
ensembl.org
As new human assemblies become available on beta.ensembl.org - which human reference genome will you choose? This article explores the question with insights from Ensembl’s own Fergal Martin - www.nature.com/articles/s41...

#HumanGenomics #Pangenomes #ReferenceGenomes
Choose your human genome reference wisely - Nature Methods
Scientists can choose between multiple human genome references, and a pangenome reference is coming. Deciding what to use when is not quite straightforward.
www.nature.com
November 4, 2025 at 12:28 PM
ensembl.org
Last day to add your input for #phytopathogen genome resources! Complete the survey before it closes: qualtricsxmpy46tq866.qualtrics.com/jfe/form/SV_...
October 31, 2025 at 3:42 PM
Reposted by Ensembl
veupathdb.org
📣Advance your skills in #pathogen genomics — no coding required — with the #Fungal Pathogen Genomics (Virtual) course #FungiDB @ensembl.org #mycocsm @yeastgenome.bsky.social #CGD
🗓️ 1–5 June 2026 Deadline: 16 March 2026
Apply here: coursesandconferences.wellcomeconnectingscience.org/event/fungal...
October 29, 2025 at 2:43 PM
ensembl.org
Ensembl Beta 14 is now live! We've added many more genomes, including Uroteuthis edulis, the Swordtip squid from the Aquatic Symbiosis Project. Find out if your favourite species is available with Ensembl Beta's Species Selector: zurl.co/BRLSE

#Ensembl #NewRelease
A screenshot of the Species Selector app on the new Ensembl website, beta.ensembl.org.
October 16, 2025 at 3:07 PM