Lightnews — Scholar-powered news

Reposted by James Cotton

Cryptosporidium Meeting UK 2026 @cryptouk26.bsky.social · 1d

Save the date, next Cryptosporidium meeting in Edinburgh May 22-24, 2026. Register for email updates via the QR code below.

5 3

Reposted by James Cotton

Richard McCulloch @rmc9z.bsky.social · 2d

Our lab has two funded PhDs to start in 2026 via the NorthWestBio programme

Project details here
www.gla.ac.uk/postgraduate...
...and here
www.gla.ac.uk/postgraduate...

Application deadline is Nov 21st 2025; apply here:
www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

www.gla.ac.uk

5 8

James Cotton @jamesacotton.bsky.social · 1d

My colleague Roz Laing also has a veterinary parasitology project next year, investigating how epigenetics might be involved in mediating drug resistance in parasitic nematodes www.gla.ac.uk/postgraduate....

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Roz Laing

www.gla.ac.uk

2

James Cotton @jamesacotton.bsky.social · 1d

#3 Developing improved molecular diagnostics for Cryptosporidium in drinking water, and using these (and some genomics) to understand sources of contamination. Led by Frank Katzer at Moredun and Willie Weir in Glasgow www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - Willie Weir

www.gla.ac.uk

1

James Cotton @jamesacotton.bsky.social · 1d

#2 - a project taking a comparative approach to DNA replication and plasticity/mutation in kinetoplastids, expanding work form the 'model' parasites to other kinetoplastid lineages, with Richard McCulloch and Sarah Allinson in Lancaster: www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Understanding Pathogens, from Molecules to Phenotypes - Richard McCulloch

www.gla.ac.uk

1 2

James Cotton @jamesacotton.bsky.social · 1d

I'm also co-supervising a few other projects:
#1: an inter-disciplinary project on chemical biology of Base-J in kinetoplastids, led by Glenn Burley @Strathclyde. We aim to develop some new chemical approaches and apply them to study kinetoplastid genetics.
www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Underpinning Bioscience - Glenn A Burley

www.gla.ac.uk

1 4

James Cotton @jamesacotton.bsky.social · 1d

The link currently has the wrong text, but hopefully will be fixed soon. Please get in touch if you have questions, and apply by 21st November via the NorthWestBio system www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - How To Apply

NorthWest Bio is a new BBSRC-funded doctoral training partnership. Discover more about the programme and how to apply.

www.gla.ac.uk

1

James Cotton @jamesacotton.bsky.social · 1d

We have a PhD position in population genomics of sheep scab mites available from October 2026. The project will investigate Psoroptes populations in the context of eradication programs on Scottish island groups and spreading drug resistance. www.gla.ac.uk/postgraduate...

University of Glasgow - Postgraduate study - Centres for Doctoral Training - NorthWest Biosciences - Our Projects - Animal Biology in Health & Disease - James Cotton

www.gla.ac.uk

1 3 3

James Cotton @jamesacotton.bsky.social · Jun 27

Univariate Regression Road
Non-Parametric Parade

If I ever build a housing estate, there will be no 'Oak Avenue'

James Cotton @jamesacotton.bsky.social · May 9

Well done Lilly!

British Association for Veterinary Parasitology @bavet-parasitol.bsky.social · May 9

🏆BAVP ECR Winners of Best Introductory Presentation🏆

Victoria Allicock 🐐 @uofguelph.bsky.social

Lilly Atkins 🐮 @uofglasgow.bsky.social

5

James Cotton @jamesacotton.bsky.social · May 9

Well done Benedict!

British Association for Veterinary Parasitology @bavet-parasitol.bsky.social · May 9

🏆 BAVP ECR Winner of Best Research Presentation🏆

Benedict Karani-
‘Genome-wide analysis of T. circ from different treatment regimes reveals stronger selection for ivermectin resistance in frequently treated lambs’
🐑🪱

@uofglasgow.bsky.social
@moredunfoundation.bsky.social

3

Reposted by James Cotton

School of Biodiversity One Health and Veterinary Medicine @sbohvm.gla.ac.uk · Apr 25

We are recruiting!

Applications are open for Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track) grade 7/8/9.

To apply, visit www.jobs.gla.ac.uk/job/senior-l...

#worldchangerswelcome

Senior Lecturer/Lecturer in One Health Microbiology (Research & Teaching Track)

This is the job description for the Senior Lecturer Grade 9 level. Please note the role is available at a Lecturer Grade 7 and 8 level. Please refer to the separate lecturer Grade 7/8 job descripti...

www.jobs.gla.ac.uk

14 10

Reposted by James Cotton

Gillian Dyer @gilly-bean.bsky.social · Mar 24

PhD Opportunity

www.findaphd.com/phds/project...

Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow on FindAPhD.com

PhD Project - Where are all the lice? Development and deployment of molecular detection technologies to quantify salmon lice in Scottish waters. at University of Glasgow, listed on FindAPhD.com

www.findaphd.com

2

Reposted by James Cotton

Dr. Jen Irwin @drjenirwin.bsky.social · Mar 21

Academic colleagues, if we claim to value equity, and if it’s currently not safe for *some* of our colleagues to travel to the US for conferences, then should *any* of us be travelling to the US? Standing up for equity isn’t about our own convenience.

3 4 29

James Cotton @jamesacotton.bsky.social · Mar 10

Possibly limited engagement. Does your network on here reach enough trilobite systematics influencers?

James Cotton @jamesacotton.bsky.social · Mar 10

not completely, but its good that you are so motivated to look less like me.

James Cotton @jamesacotton.bsky.social · Mar 10

Did you notice any way people can donate to the 'debt buying company' or similar things? Obviously I don't know the numbers but it seems like could be quite cost-effective philanthropy.

We almost look like twins in our bsky profile pictures.. 😧

2

Reposted by James Cotton

Trevor @trevorcotton.bsky.social · Mar 10

@mchshe.bsky.social Reading the Guardian this morning. You seem to be a good man. Your comment on powerlessness really resonated… I need to do more, and am fortunate enough to be able to make some small difference. Well done!

1 1 2

James Cotton @jamesacotton.bsky.social · Mar 3

Tapeworm Echinococcus multilocularis: TCGGTCCTTACCTTGCAGTTTTGTATG
doi: 10.1074/jbc.M006091200.

tapeworm Hymenolepis diminuita:
SL1: CGGTCTTACCATAAAACTTGTATG
SL2: CCGGTCTTACCTTGCAATTTTTGTATG
SL3: AATCGGTCTTACTGTACTAACTTGTATG
doi: 10.1186/s12915-020-00899-w.

thats all I can think of just now.

James Cotton @jamesacotton.bsky.social · Mar 3

No worries - i'd forgotten the nematode literature on this so nice to remind myself. You did say 'keep it coming'.

1 1

James Cotton @jamesacotton.bsky.social · Mar 3

The plant nematode Globodera pallida and G. rostochiensis have a bunch of different SLs (van Bers NEM: Characterization of genes coding for small hypervariable peptides in Globodera rostochiensis, PhD thesis. 2008, Wageningen (our paper doi.org/10.1186/gb-2... confirms this G. pallida, table S6)

James Cotton @jamesacotton.bsky.social · Mar 3

The plant parasitic nematode Heterodera glycines has a bunch of alternative SLs too: (from doi.org/10.1038/s415...)

James Cotton @jamesacotton.bsky.social · Mar 3

There are a bunch of other SL sequences in C. elegans that are used less commonly than SL1 and SL2 - the table here is from International Journal of Parasitology Vol. 26. No. IO, pp. 1025-1033. 1996

1

James Cotton @jamesacotton.bsky.social · Mar 3

Hey Franck - the nematode Haemonchus contortus uses the same SL1 as C. elegans, but SL2 is different (GGTTTTAACCCAGTATCTCAAG). Both sequences show some variation (figure S8 of doi.org/10.1038/s420...).

Genomic and transcriptomic variation defines the chromosome-scale assembly of Haemonchus contortus, a model gastrointestinal worm - Communications Biology

Stephen Doyle et al. report the chromosome-scale genome assembly and transcriptome sequence data of Haemonchus contortus, a key parasitic nematode model. These data show nearly complete conservation o...

doi.org

1 2

James Cotton @jamesacotton.bsky.social · Feb 26

no worries - if i come across a good synthesis of the complex nematode ones I'll let you know. There is also trans-splicing in other flatworms, but not sure what the sequences are. It must be known in some e.g. Echinococcus and Hymenolepis, and probably Fasciola too.

1