RedBirb (The Internet Cardinal)
@redbirb1508.bsky.social
Texan
Web/game dev
Please send help
Dump trump, deport musk, feed loomer to the gators.
Occasional shitposts, but while all this stuff is going on, I’m fighting against the regime
Main shitpost stuff will return when the regime is dead
18
(She/Her)
Web/game dev
Please send help
Dump trump, deport musk, feed loomer to the gators.
Occasional shitposts, but while all this stuff is going on, I’m fighting against the regime
Main shitpost stuff will return when the regime is dead
18
(She/Her)
I’m very worried about this
December 12, 2025 at 6:05 PM
I’m very worried about this
Sorry that’s actually my alt account that I use to scam people
(This is a joke)
(This is a joke)
December 10, 2025 at 8:00 PM
Sorry that’s actually my alt account that I use to scam people
(This is a joke)
(This is a joke)
Used to make hedgehog noises with my dad all the time lol
December 9, 2025 at 5:37 PM
Used to make hedgehog noises with my dad all the time lol
Yeah so as someone who was in rotc that would count as zero by military standards, placing him below the requirement
December 9, 2025 at 3:38 PM
Yeah so as someone who was in rotc that would count as zero by military standards, placing him below the requirement
I do like to see the Nazis fighting each other
December 9, 2025 at 3:35 PM
I do like to see the Nazis fighting each other
Community note: this is a cat
December 8, 2025 at 5:19 AM
Community note: this is a cat
For what? Posting a travel advisory?
December 8, 2025 at 5:14 AM
For what? Posting a travel advisory?
I’m a texan by birth and by life and the heart of Texas is the people, specifically the diverse ones
People like Abbott are like tumors
People like Abbott are like tumors
December 8, 2025 at 5:10 AM
I’m a texan by birth and by life and the heart of Texas is the people, specifically the diverse ones
People like Abbott are like tumors
People like Abbott are like tumors
Make no mistake, MTG still deserves the rest of her life behind bars for what she has done
December 8, 2025 at 5:02 AM
Make no mistake, MTG still deserves the rest of her life behind bars for what she has done
These days I just say “get jolly” with an oddly threatening tone
December 8, 2025 at 5:01 AM
These days I just say “get jolly” with an oddly threatening tone
It is too late, our goal now is to reverse and minimize damage
We’re in facism, we need to get out of it
We’re in facism, we need to get out of it
December 8, 2025 at 4:57 AM
It is too late, our goal now is to reverse and minimize damage
We’re in facism, we need to get out of it
We’re in facism, we need to get out of it
ACTGTTGACCGATTGCATCTTGAAAGTCGGGTCA . . . ACGTGGTACCTAG
December 8, 2025 at 4:46 AM
ACTGTTGACCGATTGCATCTTGAAAGTCGGGTCA . . . ACGTGGTACCTAG
Unfortunately he’s not the only one… once he falls, others will take his place
December 7, 2025 at 5:02 AM
Unfortunately he’s not the only one… once he falls, others will take his place
I’m in Texas and gas is around 2.25 a gallon
December 7, 2025 at 4:58 AM
I’m in Texas and gas is around 2.25 a gallon
Oh it blocked me too :D
December 7, 2025 at 3:29 AM
Oh it blocked me too :D
DNA is hyper complex, to attempt to fit all humans into one box arbitrarily via a heavily dumbed-down idea of genetics is delusional
December 7, 2025 at 2:28 AM
DNA is hyper complex, to attempt to fit all humans into one box arbitrarily via a heavily dumbed-down idea of genetics is delusional
1. You ignored the other points
2. Who honestly actually gives a shit about other people’s genitals at birth?
3. Why can’t you just let trans people live their lives
2. Who honestly actually gives a shit about other people’s genitals at birth?
3. Why can’t you just let trans people live their lives
December 6, 2025 at 11:27 PM
1. You ignored the other points
2. Who honestly actually gives a shit about other people’s genitals at birth?
3. Why can’t you just let trans people live their lives
2. Who honestly actually gives a shit about other people’s genitals at birth?
3. Why can’t you just let trans people live their lives
Except for the fact that science and surgery says otherwise
Also there’s plenty of animals who can change their sexes.
Not to mention the fact that DNA is extremely complex and it’s not truly possible to put every human into one of two boxes
Also there’s plenty of animals who can change their sexes.
Not to mention the fact that DNA is extremely complex and it’s not truly possible to put every human into one of two boxes
December 6, 2025 at 10:13 PM