Eric Ma
@ericmjl.bsky.social
Senior Principal Data Scientist, Moderna. Trying to follow Jesus.
Tired of repeating yourself to coding agents? Agents should actually learn from our feedback. AGENTS .md and simple playbooks helped my agents improve week by week—less babysitting, more progress. Tried this? Let me know or repost! buff.ly/5qi4pic #.ai #.automation
January 29, 2026 at 12:02 PM
Tired of repeating yourself to coding agents? Agents should actually learn from our feedback. AGENTS .md and simple playbooks helped my agents improve week by week—less babysitting, more progress. Tried this? Let me know or repost! buff.ly/5qi4pic #.ai #.automation
Reposted by Eric Ma
ICE murdered Renée Good in broad daylight. Less than 3 weeks later, they killed Alex Pretti, shooting him 10 times. Every day, we watch as people are ripped from their cars, their homes, their lives.
We can't allow ourselves to look away from this cruelty. Abolish ICE.
We can't allow ourselves to look away from this cruelty. Abolish ICE.
January 26, 2026 at 10:14 PM
ICE murdered Renée Good in broad daylight. Less than 3 weeks later, they killed Alex Pretti, shooting him 10 times. Every day, we watch as people are ripped from their cars, their homes, their lives.
We can't allow ourselves to look away from this cruelty. Abolish ICE.
We can't allow ourselves to look away from this cruelty. Abolish ICE.
Bioinformatics fixed my browser bug. DNA sequence alignment beat string normalization for messy text highlighting. Smith-Waterman, a DNA algorithm, solved my canvas-chat issue. Cross-domain ideas really work! Ever tried a wild fix? Comment or share! buff.ly/wnq3Ewz #.webdev #.algorithms
How I fixed a browser selection bug with sequence alignment algorithms
written by Eric J. Ma on 2026-01-06 | tags: javascript bioinformatics katex canvas algorithms bugfix highlighting selection web development ui
buff.ly
January 22, 2026 at 12:01 PM
Bioinformatics fixed my browser bug. DNA sequence alignment beat string normalization for messy text highlighting. Smith-Waterman, a DNA algorithm, solved my canvas-chat issue. Cross-domain ideas really work! Ever tried a wild fix? Comment or share! buff.ly/wnq3Ewz #.webdev #.algorithms
First contact with GLM-4.7 and... yeah, it feels a lot like Opus 4.5. One-shotting coding problems. I gotta probe where its limits are.
January 18, 2026 at 10:23 PM
First contact with GLM-4.7 and... yeah, it feels a lot like Opus 4.5. One-shotting coding problems. I gotta probe where its limits are.
Ever wish LLM chats could branch like your thoughts? Linear chat holds us back—so I built Canvas Chat for nonlinear exploration. Open-source, infinite canvas for branching and merging ideas with Claude, GPT, and more. Repost or comment if this sparks ideas! buff.ly/KaFK4fR #.ai #.opensource
Canvas Chat: A Visual Interface for Thinking with LLMs
written by Eric J. Ma on 2025-12-31 | tags: ai llm opencode claude visualization tools productivity
buff.ly
January 15, 2026 at 12:01 PM
Ever wish LLM chats could branch like your thoughts? Linear chat holds us back—so I built Canvas Chat for nonlinear exploration. Open-source, infinite canvas for branching and merging ideas with Claude, GPT, and more. Repost or comment if this sparks ideas! buff.ly/KaFK4fR #.ai #.opensource
AI themed my tmux bar—no plugins needed. AI let me focus on design, not syntax. Claude + OpenCode turned ideas into a terminal I love. You just need vision! How has AI changed your workflow? Repost or comment! buff.ly/aCXmjK1 #tmux #aipairprogramming
How I Themed My tmux with OpenCode + Claude (And When to Switch Models)
written by Eric J. Ma on 2025-12-27 | tags: ai opencode claude tmux terminal creativity workflow pair-programming
buff.ly
January 8, 2026 at 12:01 PM
AI themed my tmux bar—no plugins needed. AI let me focus on design, not syntax. Claude + OpenCode turned ideas into a terminal I love. You just need vision! How has AI changed your workflow? Repost or comment! buff.ly/aCXmjK1 #tmux #aipairprogramming
I don't code anymore—I build. AI lets me ship projects by describing what I want, not how to do it. In 10 days, I shipped 6 projects with OpenCode + Claude Opus 4.5. The gap between idea and product is tiny now. Would you try this? Repost or comment! buff.ly/blroW24 #ai #buildfast
You Can Just Make Stuff with OpenCode and Claude Opus 4.5
written by Eric J. Ma on 2025-12-28 | tags: ai opencode claude automation workflow llm reasoning development review tools
buff.ly
January 1, 2026 at 12:00 PM
I don't code anymore—I build. AI lets me ship projects by describing what I want, not how to do it. In 10 days, I shipped 6 projects with OpenCode + Claude Opus 4.5. The gap between idea and product is tiny now. Would you try this? Repost or comment! buff.ly/blroW24 #ai #buildfast
atggaacgccgctattgccatcgcattagcaccatggcgagcgcgaacgatcatgcgccgccgtataacgaatggtatgaagcgcgc!
(if you know, you know what to do!)
(if you know, you know what to do!)
December 25, 2025 at 9:41 PM
atggaacgccgctattgccatcgcattagcaccatggcgagcgcgaacgatcatgcgccgccgtataacgaatggtatgaagcgcgc!
(if you know, you know what to do!)
(if you know, you know what to do!)
🎄Merry Christmas to all! 104 blog posts. 2 years. Here’s what changed for me. Writing weekly turned AI into a true collaborator. Lessons on coding agents, Bayesian stats, and biotech leadership—shared honestly. What did 2025 teach you? Comment or repost! buff.ly/Kkebg57 #blogging #datascience
Two years of weekly blogging and what 2025 taught me
written by Eric J. Ma on 2025-12-25 | tags: blogging retrospective coding agents llms bayesian biotech career writing marimo modal data science
buff.ly
December 25, 2025 at 12:00 PM
🎄Merry Christmas to all! 104 blog posts. 2 years. Here’s what changed for me. Writing weekly turned AI into a true collaborator. Lessons on coding agents, Bayesian stats, and biotech leadership—shared honestly. What did 2025 teach you? Comment or repost! buff.ly/Kkebg57 #blogging #datascience
Why do your best work if your company won’t notice? I think it’s about investing in yourself, not just your job. I share how building reputation and resilience pays off down the road. Ever had effort pay off later? Comment or share! buff.ly/SyXPuJc #careeradvice
The selfish reason to do your best work
written by Eric J. Ma on 2025-12-17 | tags: career growth work philosophy resilience reputation leadership mistakes success advice
buff.ly
December 18, 2025 at 12:01 PM
Why do your best work if your company won’t notice? I think it’s about investing in yourself, not just your job. I share how building reputation and resilience pays off down the road. Ever had effort pay off later? Comment or share! buff.ly/SyXPuJc #careeradvice
Stop letting coding agents run wild—take control for better results. AI is a collaborator, not just a tool. My top tips: plan with AI, write docs/tests first, and use AGENTS.md as your agent’s guidebook. Got your own agent tips? Share below! buff.ly/kudW7pd #aiagents #productivity
December 11, 2025 at 12:00 PM
Stop letting coding agents run wild—take control for better results. AI is a collaborator, not just a tool. My top tips: plan with AI, write docs/tests first, and use AGENTS.md as your agent’s guidebook. Got your own agent tips? Share below! buff.ly/kudW7pd #aiagents #productivity
Reposted by Eric Ma
3. A massive 24 year long Danish study demonstrated that, no, aluminium adjuvants in vaccines are not dangerous. They save around 4 million lives a year (11k lives A DAY.)
www.altmetric.com/de...
Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai...
4/8
www.altmetric.com/de...
Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai...
4/8
July 21, 2025 at 4:12 PM
3. A massive 24 year long Danish study demonstrated that, no, aluminium adjuvants in vaccines are not dangerous. They save around 4 million lives a year (11k lives A DAY.)
www.altmetric.com/de...
Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai...
4/8
www.altmetric.com/de...
Explained in glorious detail by @sailorrooscout.bsky.social here: bsky.app/profile/sai...
4/8
'Folk statistics' is costing science billions. AI can help, but only if we build it right. I built an AI stats agent for experiment design—sharing what worked, what failed, and why prompts matter. Faced these issues? Repost or comment! buff.ly/UGinNw9 #ai #statistics
What does it take to build a statistics agent?
written by Eric J. Ma on 2025-12-02 | tags: statistics biotech reproducibility experiments research automation ai data open source bayesian
buff.ly
December 3, 2025 at 12:00 PM
'Folk statistics' is costing science billions. AI can help, but only if we build it right. I built an AI stats agent for experiment design—sharing what worked, what failed, and why prompts matter. Faced these issues? Repost or comment! buff.ly/UGinNw9 #ai #statistics
Coding agents can access any repo—no workspace limits! Just give Copilot or Claude the file path and skip the hassle. I stopped copying files and juggling configs. It’s way simpler than I thought. Would you try this? Comment or share! buff.ly/EP7thlP #codingagents #productivity
How to Reference Code Across Repositories with Coding Agents
written by Eric J. Ma on 2025-11-17 | tags: automation coding agents workflows productivity ai filesystem reference workspaces shell
buff.ly
November 26, 2025 at 1:00 PM
Coding agents can access any repo—no workspace limits! Just give Copilot or Claude the file path and skip the hassle. I stopped copying files and juggling configs. It’s way simpler than I thought. Would you try this? Comment or share! buff.ly/EP7thlP #codingagents #productivity
307 lines of agent code—now just 4. Graph-based LLMs are clearer and more powerful. PocketFlow let me rebuild my AgentBot with a tiny, declarative graph. Cleaner code, instant visualization, and a new mindset for agents. Would you try this? Repost or comment! buff.ly/vQo50AX #llm #aiagents
How I Replaced 307 Lines of Agent Code with 4 Lines
written by Eric J. Ma on 2025-11-16 | tags: llm graphs agents automation pocketflow llamabot python workflows abstractions state
buff.ly
November 19, 2025 at 12:02 PM
307 lines of agent code—now just 4. Graph-based LLMs are clearer and more powerful. PocketFlow let me rebuild my AgentBot with a tiny, declarative graph. Cleaner code, instant visualization, and a new mindset for agents. Would you try this? Repost or comment! buff.ly/vQo50AX #llm #aiagents
Coding agents can wreck your repo in seconds. Auto-approve only read-only commands—never risky ones. I share my setup for safe agent autonomy and lessons learned. How do you keep agents in check? Comment or repost! buff.ly/PetnnVz #ai #automation
Safe ways to let your coding agent work autonomously
written by Eric J. Ma on 2025-11-08 | tags: automation productivity coding agents safety workflow development prompting command line ai
buff.ly
November 12, 2025 at 3:03 PM
Coding agents can wreck your repo in seconds. Auto-approve only read-only commands—never risky ones. I share my setup for safe agent autonomy and lessons learned. How do you keep agents in check? Comment or repost! buff.ly/PetnnVz #ai #automation
AI agents + Marimo notebooks = Python on autopilot. Letting AI write and check my Marimo code is a total workflow upgrade. The --watch flag and marimo check catch errors fast and keep me moving. Would you try this? Repost or comment! buff.ly/6LDN1RV #python #datascience
November 5, 2025 at 3:05 PM
AI agents + Marimo notebooks = Python on autopilot. Letting AI write and check my Marimo code is a total workflow upgrade. The --watch flag and marimo check catch errors fast and keep me moving. Would you try this? Repost or comment! buff.ly/6LDN1RV #python #datascience
By definition, AI agents are always going to be out of date. AI agents need live, searchable knowledge. I share how LlamaBot's MCP server keeps docs fresh and accessible for any LLM agent. How can this help you? Repost or comment! buff.ly/5td8FNC #ai #documentation
How to expose any documentation to any LLM agent
written by Eric J. Ma on 2025-10-19 | tags: llm documentation ai mcp workflow context search knowledge development automation
buff.ly
October 29, 2025 at 2:05 PM
By definition, AI agents are always going to be out of date. AI agents need live, searchable knowledge. I share how LlamaBot's MCP server keeps docs fresh and accessible for any LLM agent. How can this help you? Repost or comment! buff.ly/5td8FNC #ai #documentation
Skills cut token costs—MCP servers win for sharing. Which is better for LLMs? Skills = fast, local tweaks. MCP = team standard. I compared Anthropic's skills repo to MCP servers—real trade-offs, not just hype. Which would you use? Repost or comment! buff.ly/zhV1XfO #llm #aiworkflows
Exploring Skills vs MCP Servers
written by Eric J. Ma on 2025-10-20 | tags: anthropic skills token efficiency llm automation customization workflows development mcp
buff.ly
October 22, 2025 at 2:06 PM
Skills cut token costs—MCP servers win for sharing. Which is better for LLMs? Skills = fast, local tweaks. MCP = team standard. I compared Anthropic's skills repo to MCP servers—real trade-offs, not just hype. Which would you use? Repost or comment! buff.ly/zhV1XfO #llm #aiworkflows
Coding agents flop without real workflows—prompts aren't enough. Discipline and feedback loops make agents useful. TDD-first, external memory, and fast iteration changed my game. What’s your best agent tip? Comment or share! buff.ly/yH5Hjkv #aicoding #devworkflow
October 15, 2025 at 2:01 PM
Coding agents flop without real workflows—prompts aren't enough. Discipline and feedback loops make agents useful. TDD-first, external memory, and fast iteration changed my game. What’s your best agent tip? Comment or share! buff.ly/yH5Hjkv #aicoding #devworkflow
What if your coding agent could remember your preferences? AGENTS.md lets you train your LLM agent like an employee. This one file made my workflow smoother—no more repeating myself! Would you try this? Repost or comment! buff.ly/LinjaUs #.aiagents #.devtips
October 8, 2025 at 2:06 PM
What if your coding agent could remember your preferences? AGENTS.md lets you train your LLM agent like an employee. This one file made my workflow smoother—no more repeating myself! Would you try this? Repost or comment! buff.ly/LinjaUs #.aiagents #.devtips
Ultralearning is a superpower to mastering tough skills quickly. Courses aren't enough—self-driven ultralearning is the real unlock. I break down how ultralearning helps you grow fast, whether it's bio, software, or any field. What will you ultralearn next? buff.ly/2l4z68Z #ultralearning #growth
How data scientists can master life sciences and software skills for biotech using ultralearning
written by Eric J. Ma on 2025-10-01 | tags: biotech ultralearning datascience lifesciences software learning career skills modeling feedback
buff.ly
October 2, 2025 at 2:02 PM
Ultralearning is a superpower to mastering tough skills quickly. Courses aren't enough—self-driven ultralearning is the real unlock. I break down how ultralearning helps you grow fast, whether it's bio, software, or any field. What will you ultralearn next? buff.ly/2l4z68Z #ultralearning #growth
Still fighting Python environment headaches? I’ve moved to pixi—automation and new tools are the future. My Data Science Bootstrap Notes now use pixi, uv, and AI. This is my recommended workflow for 2025. Would you make the switch? Comment or repost! buff.ly/MoXJJhL #.datascience #.python
September 24, 2025 at 12:20 PM
Still fighting Python environment headaches? I’ve moved to pixi—automation and new tools are the future. My Data Science Bootstrap Notes now use pixi, uv, and AI. This is my recommended workflow for 2025. Would you make the switch? Comment or repost! buff.ly/MoXJJhL #.datascience #.python
AI isn’t just for code—here’s how I use it to boost my career. LLMs help me prep for negotiations, updates, and tough convos. 10 ways I save time and stand out at work, with prompts you can steal. Which would you try? Comment or repost! buff.ly/OkXup6p #aihacks #careerdevelopment
How to use AI to accelerate your career in 2025
written by Eric J. Ma on 2025-09-01 | tags: productivity negotiation presentations llm automation communication competencies ghostwriting updates ai
buff.ly
September 17, 2025 at 11:02 AM
AI isn’t just for code—here’s how I use it to boost my career. LLMs help me prep for negotiations, updates, and tough convos. 10 ways I save time and stand out at work, with prompts you can steal. Which would you try? Comment or repost! buff.ly/OkXup6p #aihacks #careerdevelopment
Ever wonder why your stats brilliance doesn’t land with lab scientists? Clarity beats complexity every time. Here’s how I learned to lead with decisions, not methods. What’s your best tip for bridging the gap? buff.ly/8Zuli8E #biotech #datatips
How to communicate with lab scientists (when you're the data person)
written by Eric J. Ma on 2025-08-24 | tags: biotech communication decisions statistics translation collaboration trust meetings probability stakeholders
buff.ly
September 10, 2025 at 11:02 AM
Ever wonder why your stats brilliance doesn’t land with lab scientists? Clarity beats complexity every time. Here’s how I learned to lead with decisions, not methods. What’s your best tip for bridging the gap? buff.ly/8Zuli8E #biotech #datatips