Prof_GD_Foster
banner
profgdfoster.bsky.social
Prof_GD_Foster
@profgdfoster.bsky.social
Retired Prof in Molecular Plant Pathology: Emeritus in Everyway: enjoys life voraciously: enjoys beer: enjoys family & 2 dogs even more than beer(!) L'pool FC through thick & thin
Reposted by Prof_GD_Foster
Researchers have designed an electrode that allows for a month-long, noninvasive method of studying physiology and health in a diverse array of plants.

Learn more in this week’s issue of #ScienceAdvances: https://scim.ag/4aay3yP
January 23, 2026 at 10:53 PM
Reposted by Prof_GD_Foster
Our researchers reveal that light pollution disrupts nocturnal insects & spiders' movements.🏙️🕷️

Dr Rochelle Meah & Prof Nicholas Roberts highlight two key effects:

1️⃣ Masked day-to-night transitions. 🌙🕷️
2️⃣ Blinded polarized light for navigation.☀️🦋

Read➡️: www.sciencedirect.com/science/arti...
Light pollution creates multiple threats to the movement ecology of nocturnal arthropod taxa
Light pollution is a major contributing factor to declines in global biodiversity1,2 that is steadily increasing in both severity and spatial extent.3…
www.sciencedirect.com
January 5, 2026 at 9:26 AM
Reposted by Prof_GD_Foster
Last chance to apply for our funded PhD opportunity. w. Prof. Fredric Coulon @ Cranfield University. This will investigate expansion of ML models for AMR phenotype detection to agriculture settings to create a sensor-ready hit list.
Detail here:
www.findaphd.com/phds/project...
From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading on FindAPhD.com
PhD Project - From Genomic Context to Sensor Design: Computational Identification of AMR Biomarkers in Agriculture (project at Queen's University Belfast) at University of Reading, listed on FindAPhD....
www.findaphd.com
January 23, 2026 at 6:41 PM
Reposted by Prof_GD_Foster
UKRI pauses several funding calls amid priorities shake-up

The applicant-led MRC funding calls on pause include research grants, partnership grants and new investigator research grants made available through the council’s research boards.

www.researchprofessional.com/news-article...
Research Professional Sign-in
www.researchprofessional.com
January 19, 2026 at 5:24 PM
Reposted by Prof_GD_Foster
www.findaphd.com/phds/project... interested in bacterial antagonism? PhD opportunity in our team, see below. Please repost!
Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University on FindAPhD.com
PhD Project - Characterising antibacterial toxins in the food-borne pathogen Listeria monocytogenes at Newcastle University, listed on FindAPhD.com
www.findaphd.com
January 23, 2026 at 10:33 AM
Needed hot sausage roll and hot drink as beach very windy and cold 🥶
January 23, 2026 at 5:53 PM
Before I retired, colleagues couldn’t believe that I’d just walk away easily. Saying I was so passionate about science and lecturing and my commitment to the university as a whole. You’ll get bored they said.

Err…..no 😂

Best life after 🙃
January 23, 2026 at 5:50 PM
December 31, 2025 at 11:38 PM
Available to a good home: A beer belly...I've been looking after it over Xmas as I can't locate it's owner. It's not damaged..... It follows me everywhere and is very cuddly.
December 31, 2025 at 2:39 PM
I turned my mine down again. The just won’t leave me be.

news.sky.com/story/new-ye...
New Year Honours: Idris Elba, Torvill and Dean, and Lionesses among those recognised
A huge number of people earned gongs this year - here are some of the stand-out names of the 1,157 people recognised.
news.sky.com
December 31, 2025 at 2:39 PM
Something for the nerds out there....
CACGCCCCCCCCTACAACGAGTGGTACGAGGCCAGGACGTGGGAAGAACCCTCG
December 31, 2025 at 2:33 PM
Been a while since I published children’s books. But now that our wee man is 22 months & LOVES books, how could Granny & Gramps not write a new one.

Now available in all good book shops and all online sites

Dylan and the Dinosaur 🦖

amzn.eu/d/2vyxxt2
Amazon.co.uk
amzn.eu
December 26, 2025 at 8:08 PM
Publish or Perish: A Humorous Party Game about Academic Publishing

The Publish or Perish Game is a humorous party game about academic publishing. Players race to publish manuscripts with useless nonsense while sabotaging each other's research!!!!!

publishorperish.games?utm_medium=p...
Publish or Perish: A Humorous Party Game about Academic Publish
Welcome to the chaotic life of academic publishing. In this game, you are a clueless researcher trying to do the one and only thing that matters in your academic life: churning out publications, fast....
publishorperish.games
December 18, 2025 at 11:13 AM
One man (little old me) and his dog.
December 16, 2025 at 7:58 PM
December 10, 2025 at 6:38 PM
Oh how us virologists ranted and raved. But no one listened.

‘Too little, too late’: damning report condemns UK’s Covid response
November 20, 2025 at 11:52 PM
Reposted by Prof_GD_Foster
NEW from me:

Political hostility, high visa fees and (in the case of the UK) stagnant incomes are making the UK and US less attractive destinations for top international talent.

That steep decline in the appeal of moving to the US after 2016 is 👀
October 31, 2025 at 2:32 PM
Back in gods homeland the great wee Norn Iron. The wind is howling, the wind is horizontal, yep we are deffo home.
October 27, 2025 at 8:17 PM
My view as a virologist over 2 years before COVID hit !!
October 24, 2025 at 4:33 PM
Very appropriate 😂😂😂

My better half would agree 🙃
October 20, 2025 at 4:01 PM
Our kids never threw out a book their entire lives. Therefore we’ve about 25 years worth stored in our loft for both of them. We’ve finally decided to sort

Finding some classics. Fishing with Foster….The legend begins 😂 could change ‘fishing’ for a wide range of things 😂😂😂
October 20, 2025 at 3:14 PM
Deffo me towards the end….. 😂
October 18, 2025 at 12:57 PM
Only UK people will understand and also those of a certain age. ‪Still very very proud of all my badges especially the silver. Still have all my letters from Biddy Baxter. The nicest person I’ve ever met in my childhood universe. ‬
‪#BluePeter‬
October 16, 2025 at 9:56 PM