VastDB
@vastdb.bsky.social
VastDB is a repository of quantitative profiles of alternative splicing events and GE data across different tissues and species. Developed at @CRGenomica.
Website: https://t.co/gOCIXBbxcO
Website: https://t.co/gOCIXBbxcO
Reposted by VastDB
Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish.
Hosted by @mirimiam.bsky.social
evomedgenomics.com/events/exter...
Hosted by @mirimiam.bsky.social
evomedgenomics.com/events/exter...
November 5, 2025 at 11:18 PM
Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish.
Hosted by @mirimiam.bsky.social
evomedgenomics.com/events/exter...
Hosted by @mirimiam.bsky.social
evomedgenomics.com/events/exter...
Reposted by VastDB
Last days to apply! Cool project, cool cities! :-)
(Please repost! π)
(Please repost! π)
π¨π¨π¨
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
www.upf.edu
September 22, 2025 at 7:04 AM
Last days to apply! Cool project, cool cities! :-)
(Please repost! π)
(Please repost! π)
Reposted by VastDB
Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life.
www.nature.com/articles/s41...
www.nature.com/articles/s41...
September 24, 2025 at 3:12 PM
Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life.
www.nature.com/articles/s41...
www.nature.com/articles/s41...
Reposted by VastDB
π¨π¨π¨ New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social.
www.annualreviews.org/content/jour...
www.annualreviews.org/content/jour...
September 1, 2025 at 10:20 AM
π¨π¨π¨ New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social.
www.annualreviews.org/content/jour...
www.annualreviews.org/content/jour...
Reposted by VastDB
π¨π¨π¨
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
www.upf.edu
July 23, 2025 at 2:28 PM
π¨π¨π¨
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
Please RT!
We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.
Deadline: 30/09/25π
Reposted by VastDB
"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization".
In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7
tinyurl.com/45k7kbmp
In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7
tinyurl.com/45k7kbmp
March 18, 2025 at 1:53 PM
"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization".
In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7
tinyurl.com/45k7kbmp
In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7
tinyurl.com/45k7kbmp
Reposted by VastDB
The job call is officially open. If you're interested, please apply through this link ASAP! π
www.mdc-berlin.de/career/jobs/...
Please RT! π
www.mdc-berlin.de/career/jobs/...
Please RT! π
January 21, 2025 at 5:25 PM
The job call is officially open. If you're interested, please apply through this link ASAP! π
www.mdc-berlin.de/career/jobs/...
Please RT! π
www.mdc-berlin.de/career/jobs/...
Please RT! π
Reposted by VastDB
π Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social π
A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu
elifesciences.org/reviewed-pre...
Thread π1/9
A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu
elifesciences.org/reviewed-pre...
Thread π1/9
Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish
elifesciences.org
December 30, 2024 at 4:07 PM
π Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social π
A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu
elifesciences.org/reviewed-pre...
Thread π1/9
A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu
elifesciences.org/reviewed-pre...
Thread π1/9
Reposted by VastDB
π¨π¨π¨
If you're a bioinformatician who loves:
𧬠#SingleCell #LongReadSequencing & #AlternativeSplicing
π Collaborating and travelling
Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com
Please RT! π
If you're a bioinformatician who loves:
𧬠#SingleCell #LongReadSequencing & #AlternativeSplicing
π Collaborating and travelling
Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com
Please RT! π
December 23, 2024 at 3:54 PM
π¨π¨π¨
If you're a bioinformatician who loves:
𧬠#SingleCell #LongReadSequencing & #AlternativeSplicing
π Collaborating and travelling
Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com
Please RT! π
If you're a bioinformatician who loves:
𧬠#SingleCell #LongReadSequencing & #AlternativeSplicing
π Collaborating and travelling
Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com
Please RT! π
Reposted by VastDB
Weβre recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab.
www.crg.eu/en/content/t...
www.crg.eu/en/content/t...
December 10, 2024 at 11:33 AM
Weβre recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab.
www.crg.eu/en/content/t...
www.crg.eu/en/content/t...
Reposted by VastDB
βΌ Investigadores espaΓ±oles dan un paso mΓ‘s en descifrar el misterio del autismo
Investigadores espaΓ±oles dan un paso mΓ‘s en descifrar el misterio del autismo
El trabajo, publicado en 'Nature', explica por quΓ© la pΓ©rdida de ocho aminoΓ‘cidos de cientos de una proteΓna tiene un "efecto tan fuerte" en el neurodesarrollo y abre nuevas vΓas para desarrollar tera...
eldiario.es
December 4, 2024 at 4:10 PM
βΌ Investigadores espaΓ±oles dan un paso mΓ‘s en descifrar el misterio del autismo
Reposted by VastDB
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!
english.elpais.com/science-tech...
english.elpais.com/science-tech...
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
english.elpais.com
December 5, 2024 at 11:50 AM
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!
english.elpais.com/science-tech...
english.elpais.com/science-tech...