VastDB
banner
vastdb.bsky.social
VastDB
@vastdb.bsky.social
VastDB is a repository of quantitative profiles of alternative splicing events and GE data across different tissues and species. Developed at @CRGenomica.

Website: https://t.co/gOCIXBbxcO
Reposted by VastDB
Today we had a great EvoMG Seminar by Dario Valenzano @dvalenzano.bsky.social from FLI, who told us about some of their recent aging work using the fascinating short-lived killifish.

Hosted by @mirimiam.bsky.social

evomedgenomics.com/events/exter...
November 5, 2025 at 11:18 PM
Reposted by VastDB
Last days to apply! Cool project, cool cities! :-)

(Please repost! 🙏)
🚨🚨🚨

Please RT!

We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.

Deadline: 30/09/25👇
www.upf.edu
September 22, 2025 at 7:04 AM
Reposted by VastDB
Happy to share the Biodiversity Cell Atlas white paper, out today in @nature.com. We look at the possibilities, challenges, and potential impacts of molecularly mapping cells across the tree of life.
www.nature.com/articles/s41...
September 24, 2025 at 3:12 PM
Reposted by VastDB
🚨🚨🚨 New review article on #microexons from the lab! A comprehensive recap of the current state of the field by @tahneema.bsky.social.

www.annualreviews.org/content/jour...
September 1, 2025 at 10:20 AM
Reposted by VastDB
🚨🚨🚨

Please RT!

We're looking for a postdoc to join an exciting joint project between our lab @upf.edu & @crg.eu (Barcelona) and the Sander lab @mdc-berlin.bsky.social (Berlin) investigating how alternative splicing and microexons influences the maturation of pancreatic islets.

Deadline: 30/09/25👇
www.upf.edu
July 23, 2025 at 2:28 PM
Reposted by VastDB
"The main fates after gene duplication are gene loss, redundancy, subfunctionalization and neofunctionalization".

In our new review, @fedemantica.bsky.social and I argue we are missing the most prevalent one: specialization. And the same applies to alternative splicing! 1/7

tinyurl.com/45k7kbmp
March 18, 2025 at 1:53 PM
Reposted by VastDB
The job call is officially open. If you're interested, please apply through this link ASAP! 😃

www.mdc-berlin.de/career/jobs/...

Please RT! 🙏
January 21, 2025 at 5:25 PM
Reposted by VastDB
🐟 Our new paper "Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish" is out in @elife.bsky.social 🐟

A nearly 10-year tour-de-force by Laura Lopez-Blanch and many others in the lab @crg.eu & @upf.edu

elifesciences.org/reviewed-pre...

Thread 👇1/9
Phenotypic impact of individual conserved neuronal microexons and their master regulators in zebrafish
elifesciences.org
December 30, 2024 at 4:07 PM
Reposted by VastDB
🚨🚨🚨

If you're a bioinformatician who loves:

🧬 #SingleCell #LongReadSequencing & #AlternativeSplicing
🚀 Collaborating and travelling

Apply to work with us at the spectacular BIMSB (@mdc-berlin.bsky.social) in Berlin + @upf.edu[email protected] in Barcelona. Qs: www.transdevolab.com

Please RT! 🙏
December 23, 2024 at 3:54 PM
Reposted by VastDB
We’re recruiting a PhD student to use comparative omics to investigate why some viruses can efficiently infect both human and mosquito cells, but lead to different infection outcomes. Fully funded position by @evomg-bcn.bsky.social at our lab at UPF-CRG and the Diez lab.

www.crg.eu/en/content/t...
December 10, 2024 at 11:33 AM
Reposted by VastDB
"La importancia de apoyar la investigación en España"
👏👏👏
elpais.com/opinion/2024...
Paso adelante en la genética del autismo
El descubrimiento del mecanismo que podría explicar un gran porcentaje de los trastornos del espectro autista es un recordatorio de la importancia de apoyar la investigación española
elpais.com
December 11, 2024 at 1:17 PM
Reposted by VastDB
‼ Investigadores españoles dan un paso más en descifrar el misterio del autismo
Investigadores españoles dan un paso más en descifrar el misterio del autismo
El trabajo, publicado en 'Nature', explica por qué la pérdida de ocho aminoácidos de cientos de una proteína tiene un "efecto tan fuerte" en el neurodesarrollo y abre nuevas vías para desarrollar tera...
eldiario.es
December 4, 2024 at 4:10 PM
Reposted by VastDB
Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work!

english.elpais.com/science-tech...
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
english.elpais.com
December 5, 2024 at 11:50 AM